Skip to content

baudrly/clop

 
 

Repository files navigation

CLOP: Contrastive Learning for Omics Pre-training

CLOP is a PyTorch implementation of a CLIP-like model for learning joint embeddings of DNA sequences and their textual annotations. The model can be trained on FASTA, BED, or GFF3 files to learn meaningful representations that enable cross-modal retrieval and classification. It focuses on species and biotype as primary annotations and optional futher descriptions.

A live demo (embedding visualization, classification) is available here.

Features

  • Dual-Encoder Architecture: Separate encoders for DNA sequences and text annotations
  • Multiple Input Formats:
    • FASTA (with metadata in headers)
    • BED (with reference FASTA)
    • GFF3 (with reference FASTA)
  • Tokenization Options:
    • K-mer tokenization for DNA
    • Character-level tokenization for DNA
    • Customizable text tokenization
  • Training Features:
    • Contrastive loss with learnable temperature
    • Mixed-precision training (AMP)
    • Learning rate scheduling
    • Early stopping
  • Evaluation Metrics:
    • Retrieval metrics (MRR, Recall@K)
    • k-NN classification
    • Clustering metrics (Silhouette, Davies-Bouldin)
  • Export Options:
    • ONNX format
    • TensorFlow.js (via ONNX)
    • Embedding exports (CSV/Parquet)
  • Comprehensive Reporting:
    • Markdown and PDF reports
    • Embedding visualizations (PCA, t-SNE, UMAP)
    • Training curves

Installation

Complete installation (recommended)

A nix flake is provided to install everything for the project, including CUDA, python and uv.

Note

You will need the nix package manager on your system. (installation),

  1. Clone this repository:

    git clone https://github.com/yourusername/clop.git
    cd clop
  2. Enter the development environmnent using nix:

    nix develop --no-pure-eval --accept-flake-config \
             "./tools/nix#default" --command $0

Tip

if just is installed, you can run just dev instead and list available recipes by running just. If you have direnv on your system, run direnv allow once, then you will enter the environment whenever you cd into the directory.

Python-only installation

The project can be installed with a python dependency manager like uv, but you will need to setup CUDA yourself.

  1. Clone this repository:

    git clone https://github.com/yourusername/clop.git
    cd clop
  2. Install dependencies defined in pyproject using your favourite python package manager. The following extra dependency groups are available:

  • onnx: enables ONNX support

  • webapp: includes tensorflowjs

    # with uv
    uv sync --all-extras

Basic usage

# Direct FASTA file input

python clop.py \
  --input_file your_data.fasta \
  --input_type fasta \
  --output_dir output \
  --dna_tokenizer_type kmer \
  --kmer_k 6 \
  --epochs 20 \
  --batch_size 32

# BED/GFF files with a reference FASTA file

python clop.py \
  --input_file annotations.gff3 \
  --input_type gff3 \
  --reference_fasta reference_genome.fa \
  --output_dir gff3_output \
  --gff_feature_types gene,mRNA,ncRNA_gene

# Resuming from checkpoint

python clop.py \
  --resume_from_checkpoint output/best_model_checkpoint.pth \
  --output_dir continued_training

# Running tests

python clop.py --test_suite

# Running on a dummy example (for a quick demo)

python clop.py --run_dummy_example

Input file formats

FASTA

It's recommended that fasta files follow this convention (Species/Biotype/Description):

>sequence_id|species=Human|biotype=protein_coding|description=Example gene
ATGCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT

The script is designed to be compatible with chromosample.

BED Format

Standard BED format (6+ columns) with reference FASTA.

GFF3 Format

Standard GFF3 format with reference FASTA. Use --gff_feature_types to specify which feature types to process.

Output structure

The script creates the following directory structure:

output_dir/
├── reports/               # Generated plots and reports
├── best_model_checkpoint.pth  # Best model weights
├── checkpoint_epoch_*.pth    # Periodic checkpoints
├── dna_tokenizer_vocab.json  # DNA tokenizer vocabulary
├── text_tokenizer_vocab.json # Text tokenizer vocabulary
├── final_embeddings.csv      # Exported embeddings (if enabled)
├── dna_encoder.onnx          # ONNX export (if enabled)
├── text_encoder.onnx         # ONNX export (if enabled)
└── tfjs_*/                  # TensorFlow.js exports (if enabled)

Advanced options

Model Architecture

--embedding_dim: Dimension of embeddings (default: 128)

--hidden_dim: LSTM hidden dimension (default: 256)

--num_layers: Number of LSTM layers (default: 1)

--dropout: Dropout rate (default: 0.1)

Training Parameters

--learning_rate: Initial learning rate (default: 1e-3)

--weight_decay: L2 penalty (default: 0.01)

--lr_scheduler_patience: Epochs before reducing LR (default: 3)

--early_stopping_patience: Epochs before early stop (default: 5)

--use_amp: Enable mixed-precision training

--use_torch_compile: Use torch.compile() optimization (PyTorch 2.0+)

Export Options

--export_onnx: Export encoders to ONNX format

--export_tfjs: Export ONNX encoders to TensorFlow.js

--export_embeddings_format: Export format for embeddings (csv, parquet, both, none)

About

Contrasting Language Omics Pre-training - Training joint embeddings for sequence/annotation pairs

Topics

Resources

License

Stars

Watchers

Forks

Packages

 
 
 

Contributors

Languages

  • Python 98.6%
  • Other 1.4%