-
Notifications
You must be signed in to change notification settings - Fork 203
Alternative Processing of Reads with PEAR
We have found that some amplicons seem to fail pairing more often with VSEARCH, therefore use the below commands to stitch the reads with PEAR, then import into QIIME2, and finally trim+Q-filter in order to continue on with the standard Illumina amplicon SOP.
First steps are running PEAR and cleaning up intermediary files so that they can easily be imported into QIIME2:
run_pear.pl -g -p 4 -o stitched_reads/ raw_data/*
rename 's/.assembled/_R1_001/' stitched_reads/*.assembled*
rm stitched_reads/*discarded*
rm stitched_reads/*unassembled*
...then import into QIIME2:
mkdir reads_qza
qiime tools import \
--type SampleData[SequencesWithQuality] \
--input-path stitched_reads/ \
--output-path reads_qza/reads_stitched.qza \
--input-format CasavaOneEightSingleLanePerSampleDirFmt
...summarize the stitched reads (in order to compare to post-trimming below):
qiime demux summarize \
--i-data reads_qza/reads_stitched.qza \
--o-visualization reads_qza/reads_stitched_summary.qzv
...trim the reads (note this is the example for the ITS2 primers and will have to be changed for other sets - be aware that this uses linked anchored adapter notation to list the F+R primers as they would appear on either ends on the reconstructed insert in a 5'-3' "forward" orientation):
qiime cutadapt trim-single \
--i-demultiplexed-sequences reads_qza/reads_stitched.qza \
--p-cores 4 \
--p-front ^GTGAATCATCGAATCTTTGAA \
--p-adapter TCCTCCGCTTATTGATATGC$ \
--p-discard-untrimmed \
--p-no-indels \
--o-trimmed-sequences reads_qza/reads_trimmed_joined.qza
...finally, quality-filter the reads and create the summary:
qiime quality-filter q-score \
--i-demux reads_qza/reads_trimmed_joined.qza \
--o-filter-stats filt_stats.qza \
--o-filtered-sequences reads_qza/reads_trimmed_joined_filt.qza
qiime demux summarize \
--i-data reads_qza/reads_trimmed_joined_filt.qza \
--o-visualization reads_qza/reads_trimmed_joined_filt_summary.qzv
At this point, you then continue on as normal from Step 2.3 of the Illumina amplicon SOP.
- Please feel free to post a question on the Microbiome Helper google group if you have any issues.
- General comments or inquires about Microbiome Helper can be sent to morgan.langille@dal.ca.
Useful Links
Microbiome Helper 2
- 1.1. Overview - start here!
- 1.2. What you need to start a microbiome analysis
- 1.3. Introduction to command line
- 1.4. Introduction to R and R notebooks
- 1.5. Download tutorial data
- 1.6. Setting up environments for analysis
Microbiome Helper 2 - marker gene/amplicon
Microbiome Helper 2 - metagenome
- 3.1. Metagenomics first steps
- 3.2. Taxonomic annotation with Kraken 2
- 3.3. Functional annotation with MMSeqs 2 (and combining taxonomic and functional annotations)
- 3.4. Getting a tree for metagenomic taxonomic annotations
- 3.5. MAG assembly, binning, and curation with Anvi'o
- 3.6. AMR gene annotation with CARD RGI
- 3.7. Obtaining annotations for function/gene of interest with HMMs
Microbiome Helper 2 - downstream/statistical analysis
Tutorials